Skip to main content

Table 1 Sequences of primers for RT-PCR

From: Cardiomyocyte-targeted and 17β-estradiol-loaded acoustic nanoprobes as a theranostic platform for cardiac hypertrophy

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
GAPDH CGGGAAATCGTGCGTGAC TCGCTCCAACCGACTGCT
β-MHC ACCAGTCCATCCTCATCACC TGGCAGCAATAACAGCAAAA
Collagen 1 ACTCATGGCCAAGAAGACATC TTTGCATAGCACGCCATCG
Collagen 3 TTTGGCACAGCAGTCCAATG TCCCGAGTCGCAGACACATAT