Skip to main content

Advertisement

Table 1 Sequences of the primers used in qRT-PCR analysis

From: Delivery of siRNA in vitro and in vivo using PEI-capped porous silicon nanoparticles to silence MRP1 and inhibit proliferation in glioblastoma

Primer ID  
MRP1_Human Forward 5′ → AAGGAATGCGCCAAGACTAG → 3′
Reverse 5′ → CCTTAAACAGAGAGGGGTTC → 3′
GAPDH_Human Forward 5′ → GTGAAGGTCGGAGTCAACGG → 3′
Reverse 5′ → TGGAGGGATCTCGCTCCTGG → 3′
MRP1_Mice Forward 5′ → TGCAGAGGCATCTCAGCAACTC → 3′
Reverse 5′ → TTCGGCTATGCTGCTGTGTT → 3′
GAPDH_Mice Forward 5′ → CGACTTCAACAGCAACTCCCACTCTTCC → 3′
Reverse 5′ → TGGGTGGTCCAGGGTTTCTTACTCCTT → 3′