Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Real-time polymerase chain reaction primers used in this study

From: Lanthanum phosphate/chitosan scaffolds enhance cytocompatibility and osteogenic efficiency via the Wnt/β-catenin pathway

Gene Accession number Primers (up: forward; down: reverse) Product size (bp)
GAPDH NM_017008.4 GCAAGAGAGAGGCCCTCAG
TGTGAGGGAGATGCTCAGTG
74
OCN NM_013414.1 TCACTCTGCTGGCCCTGACT
CCCTCCTGCTTGGACATGAA
100
ALP NM_013059.1 CATCATCATGTTCCTGGGAG
GACCTGAGCGTTGGTGTTGT
163
Col-I NM_053304.1 GGCGAGTGCTGTCCTTTCTG
CTTCCCCATCATCTCCGTTCTCTTCC
434