Skip to main content

Advertisement

Table 1 Real time PCR primer pairs used for quantification of human TLR mRNA

From: G2-S16 dendrimer microbicide does not interfere with the vaginal immune system

TLR Forward primer Reverse primer Amplicon size (bp)
LR1 GGTCTTGCTGGTCTTAGGAGAGAC CTGAAGTCCAGCTGACCCTGTAGCTTCACG 372
TLR2 GGCCAGCAAATTACCTGTGTG CTGAGCCTCGTCCATGGGCCACTCC 637
TLR3 CGGGCCAGCTTTCAGGAACCTG GGCATGAATTATATATGCTGC 400
TLR4 TGCAATGGATCAAGGACCAGAGGC GTGCTGGGACACCACAACAATCACC 449
TLR5 CCTCATGACCATCCTCACAGTCAC GGCTTCAAGGCACCAGCCATCTC 355
TLR6 CCAAGTGAACATATCAGTTAATACTTTAGGGTGC CTCAGAAAACACGGTGTACAAAGCTG 358
TLR7 CTCCCTGGATCTGTACACCTGTGAG CTCCCACAGAGCCTTTTCCGGAGCT 551
TLR8 GTCCTGGGGATCAAAGAGGGAAGAG CTCTTACAGATCCGCTGCCGTAGCC 581
TLR9 GCGAGATGAGGATGCCCTGCCCTACG TTCGGCCGTGGGTCCCTGGCAGAAG 510
TLR10 CAGAGGTCATGATGGTTGGATGG GACCTAGCATCCTGAGATACCAGGGCAG 256