Skip to main content

Table 1 The sequences of all primers

From: Chitosan oligosaccharides packaged into rat adipose mesenchymal stem cells-derived extracellular vesicles facilitating cartilage injury repair and alleviating osteoarthritis

Primer Sequence (5′–3′)
GAPDH-ratF AGACAGCCGCATCTTCTTGT
GAPDH-ratR CTTGCCGTGGGTAGAGTCAT
IL-1β-rF CCCTGCAGCTGGAGAGTGTGG
IL-1β-rR TGTGCTCTGCTTGAGAGGTGCT
COL1A1-rF GCATCAGGGTTTCAGAGCA
COL1A1-rR CGTTGGGTCATTTCCACAT
COL2A1-rF TTCCTCCGTCTACTGTCCACTGA
COL2A1-rR CTACATCATTGGAGCCCTGGAT
OPN-rF CCAGCCAAGGACCAACTACA
OPN-rR AGTGTTTGCTGTAATGCGCC
ALP-rF GCAGTATGAATTGAATCGGAACAAC
ALP-rR ATGGCCTGGTCCATCTCCAC
c-Myc-rF CTGCTGTCCTCCGAGTCCTC
c-Myc-rR GGGGGTTGCCTCTTTTCCAC
OCN-rF ACCATCTTTCTGCTCACTCTGCT
OCN-rR CCTTATTGCCCTCCTGCTTG
RUNX2-rF CCACAGAGCTATTAAAGTGA
RUNX2-rR AACAAACTAGGTTTAGAGTCATCAAGC
Akt1-rF CTTTATTGGCTACAAGGAACGG
Akt1-rR CAGTCTGAATGGCGGTGGT
PI3K-rF ACGGCAATGTGGAGCAGA
PI3K-rR GTCGTAGCCAATCAGGGAG
Bcl2-rF GATTGTGGCCTTCTTTGAGTTC
Bcl2-rR CAGATGCCGGTTCAGGTACT
p53-rF GCTGAGTATCTGGACGACAGG
p53-rR AGCGTGATGATGGTAAGGATG
Vps13a-rF GCATTGAGAATACCGTTTG
Vps13a-rR GAATCCCATCTGCTTTGT
Birc6-rF CACTCTGGGTCTACTGCT
Birc6-rR ATTAGGGTGACATGAAATAC
Itga1-rF CATCCCTCATAACACCACC
Itga1-rR GTTCCCATCCTCCATCTT
Ifi2712b-rF GGAGGAGTTGTGGCTGTG
Ifi2712b-rR AAATCTTGCATTGGAGGC
Gli1-rF CTCCCTCGTGGCTTTCAT
Gli1-rR GCGGCAGTCCGTCTCATA