Skip to main content

Table 1 Primer sequences used for PCR analysis

From: Targeted neutrophil-mimetic liposomes promote cardiac repair by adsorbing proinflammatory cytokines and regulating the immune microenvironment

Gene Primer sequences
Actin F: TCACCATGGATGATGATATCGC
R: ATAGGAATCCTTCTGACCCATGC
TGF-β F: CCACCTGCAAGACCATCGAC
R: CTGGCGAGCCTTAGTTTGGAC
VEGF-A F:AGGGCAGAATCATCACGAAGT
R: AGGGTCTCGATTGGATGGCA
VEGF-2 F: CAAGTGGCTAAGGGCATGGA
R: ATTTCAAAGGGAGGCGAGCA
Ang-1 F: AACCGGATTCAACATGGGCA
R: TCTCACGACAGTTGCCATCG
Ang-2 F: CTGTTGAACCAAACAGCGGAG
R: TCGAGAGGGAGTGTTCCAAGA
Bcl-2 F: CTTTGAGTTCGGTGGGGTCA
R: GGGCCGTACAGTTCCACAAA
Bax-2 F: CATGGGCTGGACATTGGACT
R: AAAGTAGGAGAGGAGGCCGT
Casp-3 F: GGCGCTCTGGTTTTCGTTAAT
R: CCGAGATGTCATTCCAGTGCT
IL-10 F: AGCCTTATCGGAAATGATCCAGT
R: GGCCTTGTAGACACCTTGGT