Table 2 Oligonucleotide sequences used for AuNP functionalization, target specificity and acceptor labeled oligonucleotides
From: BioCode gold-nanobeacon for the detection of fusion transcripts causing chronic myeloid leukemia
Oligonucleotide sequence (5′–3′) | 5′ modification | 3′ modification | |
|---|---|---|---|
Hairpin-e13a2 | ccacgccaaacgctgaagggcttcttccttatttttggcgtgg | C6-Thiol | 6-carboxyfluorcein |
Hairpin-e14a2 | cacctcgaaatctgaagggcttttgaactctgttttcgaggtg | C6-Thiol | Cy3 |
e13a2 (AJ131467.1) | ataaggaagaagcccttcagcg | – | – |
e14a2 (AJ131466.1) | cagagttcaaaagcccttcag | – | – |
Acceptor-ROX | ccacgccaaa | – | ROX |
Acceptor-Dy | cacctcgaaa | Dy-520XL mega stokes | |
BCR-e13 (NM_004327.3) | tccgctgaccatcaataaggaagaa | – | – |
BCR-e14 (NM_004327.3) | cactggatttaagcagagttcaaaa | – | – |
ABL (NM_005157.5) | gcccttcagcggccagtagcatctg | – | – |
Non-complementary | attaccagacatgcgtggtcccaac | – | – |