Skip to main content

Table 1 Aptamers specific for breast cancer

From: Aptamer selection and applications for breast cancer diagnostics and therapy

Aptamer Sequence (5′–3′) Target References
H2 GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC HER2 [40]
AS1411 GGTGGTGGTGGTTGTGGTGGTGGTGG Nucleolin [41, 42]
ERaptD4 ATACCAGCTTATTCAATTCGTTGCATTTAGGTG
CATTACGGGGGTTATCCGCTCTCTCAGATAGTA
TGTGCAATCA
ERα [43]
S6 TGGATGGGGAGATCCGTTGAGTAAGCGGGCGTGTCTCTCTGCCGCCTTGCTATGGGG SK-BR-3 cells [44]
XLX-1-A GAATTCAGTCGGACAGCGAAGTAGTTTTCCTT
CTAACCTAAGAACCCGCGGCAGTTTAATGTAG
ATGGACGAA
MDA-MB-231 cells [45]
MUC1 GCAGTTGATCCTTTGGATACCCTGG Mucin-1 [46]
HB5 AACCGCCCAAATCCCTAAGAGTCTGCACTTGT
CATTTTGTATATGTATTTGGTTTTTGGCTCTCAC
AGACACACTACACACGCACA
HER2 [47]
KMF2-1a AGGCGGCAGTGTCAGAGTGAATAGGGGATGTA
CAGGTCTGCACCCACTCGAGGAGTGACTGAGCGACGAAGACCCC
MCF-10AT1 cells [48]
SYL3C CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG EpCAM [49]