Skip to main content

Table 1 Primers for real-time polymerase chain reaction

From: Articular chondrocyte-derived extracellular vesicles promote cartilage differentiation of human umbilical cord mesenchymal stem cells by activation of autophagy

Gene names Forward primer Reverse primer
Col2a CCGTGCTCCTGCCGTTTC CTGAGGCAGTCTTTCACGTCT
Sox9 AAGCTCTGGAGACTTCTGAACG CGTTCTTCACCGACTTCCTCC
Acan CTACACGCTACACCCTCGAC ACGTCCTCACACCAGGAAAC
Col10 CGATACCAAATGCCCACAGG ATGGTCCTCTCTCTCCTGGT
Col1a GTTCAGCTTTGTGGACCTCCG GCAGTTCTTGGTCTCGTCAC
GAPDH GTCAAGGCTGAGAACGGGAA AAATGAGCCCCAGCCTTCTC
  1. Col2a: collagen type II; Sox9: SRY‐related high mobility group‐box gene 9; Acan: aggrecan; Col10: collagen type X; Col1a: collagen type I; GAPDH: glyceraldehyde‐3‐phosphate dehydrogenase