Plasmids
Plasmids required for packaging EVs were obtained from Addgene, including pHLS-EF1a-FKBP12-Gag (Addgene ID: 138,476); pHLS-EF1a-FRB-SpCas9-A (Addgene ID: 138,477); pcDNA1-Tat (Addgene ID: 138,478); pVSV-G (Addgene ID: 138,479). The construction method of vector plasmid carrying sgRNA is as follows:
Step 1 - Clone sgRNA into pENTR-AmCyan.
To clone sgRNA (targeting sequence 5′-CCTAAAACACTGATTTCAAA-3′ site) into pENTR-AmCyan (Addgene ID: 138,481), the fragment containing sgRNA 5′-CGGCCGACCGAATTCGCGGCCTTTAGGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCCTAAAACACTGATTTCAAAGTTTTAGAGCTATGCTGGAAACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACGGCCGCTCTAGAACTCGGCCG-3′ was synthesized by GENEWIZ (Suzhou, China). pENTR-AmCyan is digested into linear by restriction enzyme EgaI (NEB, MA, USA, R3505), and the synthesized fragment is cloned into the vector using ClonExpress MultiS one-step cloning kit (Vazyme, Nanjing, China, C113-01).
Step 2 - Clone sgRNA into PL-5 L-GW-A.
Gateway™ LR Clonase™ II Enzyme mix (Thermo Fisher Scientific, MA, USA, 11,791,020) was performed with PL-5 L-GW-A-sgRNA and PL-5 L-GW-A to obtain PL-5 L-RGR (miR-29b)-AmCyan-A.
Cell culture and treatment
C2C12 cells (mouse skeletal myoblasts) were obtained from ATCC and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Corning, NYC, USA, 10-013-CV) with 10% Fetal bovine serum (Biological Industries, Beit HaEmek, Israel) and 1% Penicillin-Streptomycin (KeyGEN, Nanjing, China, KGY0023) at 37 ℃ supplemented with 5% CO2. To differentiate into myotubes, C2C12 myoblasts cells were cultured in a differentiation medium (DMEM containing 2% horse serum and 1% penicillin and streptomycin) and the entire differentiation process lasted about 4 days. EV-depleted fetal bovine serum (FBS) was obtained after overnight centrifugation at 100,000 g at 4 °C (Beckman Coulter, Avanti JXN-30). For screening the optimum concentration, EVs were added to the medium for 24 h at different doses. For determining the function of EVs in muscle atrophy in vitro, EVs were added to the medium at a dose of 1 × 1010 particles/mL for 24 h, then muscle atrophy was induced. Dexamethasone (Dex, Sigma, MO, USA, D4902), TNF-α (PeproTech, NJ, USA, 315-01 A), and Ang II (Sigma, MO, USA, A9525) were used to induce muscle atrophy at the cellular level according to previously reported methods [4].
EVs production
C2C12 cells were seeded onto a 10 cm culture dish at the density of 4 million/dish. When the cells proliferated to 80% density, pHLS-EF1a-FKBP12-Gag (10 µg), pHLS-EF1a-FRB-SpCas9-A (10 µg), pcDNA1-Tat (2 µg), pVSV-G (5 µg), PL-5 L-29b-AmCyan-A (10 µg) were transfected into the cells using the transfection reagent PEI Max (1 µg/µL; Polyethylenimine Linear MW40000, Kingmorn, Shanghai, China KE1098). The ratio of plasmid and transfection reagent was 1:3 (m/m). 12 h after transfection, medium was changed using exosome-free FBS, and the cell culture supernatant was collected 48 h after the medium change.
Isolation and purification of EVs
First, the collected medium was centrifuged at 300⋅g for 10 min at 4 °C to remove all living cells. Subsequently, the supernatant was transferred to a new centrifuge tube, and the dead cells were removed by centrifugation at 2,000 g for 10 min at 4 °C. The supernatant was then transferred to a new centrifuge tube, centrifuged at 10,000⋅g for 30 min at 4 °C to remove cell debris, and finally the supernatant was transferred onto an ultracentrifuge tube, and centrifuged at 4 °C at 100,000 g for 70 min to obtain EVs. An appropriate amount of PBS was used to dissolve the pellet.
Fluorescent nanoparticle tracking analysis (FNTA)
In order to exclude non-membrane-structured nanoparticles and to detect the content of exosomes in nanoparticles more accurately, extracted EVs (1.4 × 1010 particles) were incubated with 10 µg/mL DiO (Beyotime Biotechnology, Shanghai, China, C1038) at 37 ℃ for 30 min and then centrifuged at 100,000×g for 70 min to remove excess dye, and fluorescently labeled EVs were resuspended in 2 ml sterile PBS. To calibrate the accuracy of the ZetaView Nanoparticle Tracking Analyzer (Particle Metrix) for measuring fluorescent EVs, fluorescent PS beads YG-488 (Particle Metrix, 120 − 0102) were diluted 250,000 times using sterile H2O without nanoparticles, and were injected into the instrument and calibrated. Then, the fluorescently labeled EVs were diluted 2,500 times using sterile PBS without nanoparticles, and the fluorescently labeled EVs were injected into the instrument using a syringe to set the parameters according to the instrument’s operation manual, by tracking the Brownian motion of the exosomes and combining the Stokes-Einstein equation to calculate the number of particles of fluorescently labeled EVs and the size of particle diameter. The EV measurements were repeated three times for each sample.
Transmission electron microscopy (TEM)
For TEM analyses to identify EVs, the purified exosomes were resuspended in PBS without nanoparticles, and 20 µl of EVs were mixed with an equal volume of 4% PFA. The fixed EVs were further diluted 20-fold with 2% PFA, 5 µl of this was put on the copper mesh, was let to stand for 1 min, then filter paper was used to absorb excess liquid. After being washed with double distilled water for three times and the copper mesh was left to dry naturally, and the EVs were then observed using electron microscope. The images were captured under a LVEM5 transmission electron microscope (Delong America, Montreal, QC, Canada).
Validation of EVs uptake
Extracted EVs were incubated with 2 µg/mL DiD (Beyotime Biotechnology, Shanghai, China, C1039) at 37 ℃ for 30 min and then centrifuged at 100,000 ×g for 70 min to remove excess dye. C2C12 cells were seeded onto 12-well plates at a concentration of 40,000 cells /ml. After 12 h, DiD-labeled EVs were added to the cells. After an incubation of 4 h, the cell supernatant was removed, washed three times with PBS, and digested with trypsin. Then, the cells were resuspended in PBS, their fluorescence intensity was detected using a flow cytometry (CytoFlex, Beckman, USA). To detect cellular EV uptake with confocal microscopy, C2C12 cells were seeded onto µ-Slide 8 well glass plates (Ibidi, Gräfelfing, Germany) at a density of 10,000 cells/ml, and DiD-labeled EVs were added to the cells after 12 h. After an incubation of 4 h, cells were washed 3 times with PBS, and then fixed with 4% PFA for 15 min. The nuclei were then stained with DAPI (KeyGEN, China, KGA215) and imaging of the uptake of fluorescently DiD-labeled EVs by C2C12 was detected using confocal microscopy (FV3000, Olympus, Japan).
Quantitative real-time polymerase chain reactions (qRT-PCR)
Total RNA in cells or tissues was extracted using RNA isolater Total RNA Extraction Reagent (Vazyme, Nanjing, China, R401-01). Subsequently, the RNA reverse transcription experiment was performed using the SuperScript First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific, MA, USA, 11,904,018) to synthesize cDNA. Real-time fluorescent quantitative PCR experiments were performed using the SYBR Green PCR kit (Takara, Shiga, Japan RR820A). The relative mRNA levels were measured using the 2−ΔΔCq method and 18 S rRNA was used as the internal control. For miRNA, 5 S rRNA was used as the internal control and the bulge loop miRNA qPCR primer set (RiboBio, Guangzhou, China) was used. The primers used are as follows:
mmu-18S rRNA-Forward: 5′-TCAAGAACGAAAGTCGGAGG-3′;
mmu-18S rRNA -Reverse: 5′-GGACATCTAAGGGCATCAC-3′;
mmu-Atrogin-1- Forward: 5′-CAGCTTCGTGAGCGACCTC-3′;
mmu-Atrogin-1- Reverse: 5′-GGCAGTCGAGAAGTCCAGTC-3′;
mmu-MuRF-1- Forward: 5’-GTGTGAGGTGCCTACTTGCTC-3’;
mmu-MuRF-1- Reverse: 5′-GCTCAGTCTTCTGTCCTTGGA-3′;
mmu-IL-1β- Forward: 5′-GCAACTGTTCCTGAACTCAACT-3′;
mmu-IL-1β- Reverse: 5′-ATCTTTTGGGGTCCGTCAACT-3′;
mmu-IL-6- Forward: 5′-TAGTCCTTCCTACCCCAATTTCC-3′;
mmu-IL-6- Reverse: 5′-TTGGTCCTTAGCCACTCCTTC-3′;
mmu-TNF-α- Forward: 5′-AGGCACTCCCCCAAAAGATG-3′;
mmu-TNF-α- Reverse: 5′-CCACTTGGTGGTTTGTGAGTG-3′.
T7 endonuclease I (T7EI) assay
The genomic DNA of the tissue or cells treated with EVs were used as template, and the fragment encoding miR-29b was amplified by PCR using specific primers: miR-29b-1 Forward: 5′-GCTGCACCGTGAATGTGTAA-3′, miR-29b-1 Reverse: 5′-AGGTCTTCATCCGAGCATGG-3′; miR-29b-2 Forward: 5′-TGTACATATGTTGAATGGATTTGGT-3′, miR-29b-2 Reverse: 5′-TGCTGCAACCAGGACTGAAT-3′. KOD Plus Neo (Toyobo, Osaka, Japan, KOD-401) was used for PCR. The purified PCR product was denatured and annealed in NEB buffer 2 (NEB, MA, USA, B7002S) in a total volume of 20µL. The denaturation and annealing steps are as follows: 95 ℃, 5 min; 95–75 ℃, − 0.1 ℃/cycle, 200 times; 75–15℃, − 0.1℃/cycle, 600 times; hold at 4 ℃. 1U of T7EN1 enzyme (NEB, MA, USA, M0302S) was added to the PCR product and digested at 37 °C for 1 h, followed by separation of the digested product using 2% agarose, stained with GelRED, and images were captured by ChemiDoc XRS (Bio-Rad, PA, USA).
Mouse models
Eight-week-old male C57BL/6J mice were purchased from Charles River (Beijing, China) and maintained in the SPF laboratory animal facility of Shanghai University (Shanghai, China). All procedures with animals were performed in accordance with the guidelines on the use and care of laboratory animals for biomedical research published by the National Institutes of Health (No. 85 − 23, revised 1996), and the experimental protocol was reviewed and approved by the ethical committee of Shanghai University. A detailed method of the mouse muscle atrophy models has been previously described in our work [4]. Briefly, for the mouse muscle atrophy treatment experiment, the mouse sciatic nerve was cut to make a denervation muscle atrophy model and the sham mice were generated by the same process but without cutting off the sciatic nerve. The hind limbs of the experimental mice group were fixed by a screw (0.4 × 8 mm) to construct an immobilization muscle atrophy model and while the sham mice were not fixed. For EVs-Cas9-29b therapy, the mice received an intramuscular injection of EVs at 1, 2, 4, 6, 14, 21, and 28 days after surgery at the dose of 8.5 × 1010 particles/mice. The mice were sacrificed on day 35. Gastrocnemius was harvested, muscle weight and body weight were measured. Muscle specimens were either immediately snap-frozen using liquid nitrogen and stored at -80 °C for further analyses, or embedded for histological analyses.
Western blot
PI buffer containing PMSF (KeyGEN, Nanjing, China, KGP701) was used to prepare protein lysates for cell and tissue samples. The BCA protein assay kit (Thermo Fisher Scientific, MA, USA, 23,225) was used to determine the concentration of protein samples. The protein samples were separated using SDS-PAGE gel, and the proteins were then transferred onto a PVDF membrane, which was then blocked and incubated with the primary antibody and the secondary antibody consecutively, and then visualized using the High-sig ECL Western Blotting Substrate (Tanon, Shanghai, China, 180–501). GAPDH was used as the loading control. Primary antibodies used in this study were as follows: P-AKT (S473) (1:1000, Cell Signaling Technology, MA, USA, 4060 S), AKT (1:1000, Proteintech, Wuhan, China, 10176-2-AP), P-FOXO3A (S253) (1:1000, Cell Signaling Technology, MA, USA, 9466 S), FOXO3A (1:1000, Abclonal Technology, Wuhan, China, A9270), P-mTOR (1:1000, Cell Signaling Technology, MA, USA), mTOR (1:1000, Cell Signaling Technology, MA, USA, 2972 S), P-P70S6K (1:1000, Cell Signaling Technology, MA, USA, 9204 S), P70S6K (1:1000, Cell Signaling Technology, MA, USA, 9202 S), P-4EBP1 (1:1000, Abclonal Technology, Wuhan, China, AP0030), 4EBP1 (1:1000, Abclonal Technology, Wuhan, China, A19045), Cas9 (1:1000, abcam, Cambridge, England, ab191468), VSV-G (1:1000, abcam, Cambridge, England, ab183497), CD9 (1:1000, Santa Cruz, TX, USA, sc-13,118), CD63 (1:1000, Santa Cruz, TX, USA, sc-5275), PI3 Kinase P85-α (1:500, Proteintech, Wuhan, China, 11748-1-AP), IGF-1 (1:500, Abclonal Technology, Wuhan, China, A12305), TSG-101 (1:500, Abclonal Technology, Wuhan, China, A1692), TOM-20 (1:1000, Proteintech, Wuhan, China, 11802-1-AP), Calnexin (1:500, Abclonal Technology, Wuhan, China, A15631), APOA1 (1:500, Abclonal Technology, Wuhan, China, A14211) and GAPDH (1:10000, Bioworld Technology, Nanjing, China, AP0063).
Immunofluorescence staining
Myotubes were fixed with 4% paraformaldehyde for 20 min at room temperature. After permeabilizing with 0.5% Triton X-100, the myotubes were blocked with 5% bovine serum albumin (BSA) for 2 h at room temperature. They were then incubated with primary antibody MF-20 (1:100, DSHB, IA, USA, AB-2,147,781) overnight at 4 °C. The next day, the samples were incubated with their corresponding secondary fluorescence conjugated antibodies, Alexa Fluor® 488 AffiniPure Goat Anti-Mouse IgG (H + L) (1:200, Jackson ImmunoResearch Laboratories, PA, USA, 115-545-003) at room temperature for 2 h while being protected from light. After washing the samples with PBS, nuclei were stained for DAPI (1:2000, KeyGen, Nanjing China, KGA215) and imaged. Leica fluorescence microscope (Wetzlar, Germany, DM i8) with a 20× objective lens was used to take fluorescence images. The diameter of the myotubes were analyzed using Image J software (NIH, USA) and a minimum of 40 myotubes were imaged for each group.
Detection and statistics of muscle fiber cross-sectional area
H&E staining and wheat germ agglutinin (WGA) staining were used to detect the cross-sectional area of mouse gastrocnemius muscle fibers, which has been described in detail in our previous study [10].
For H&E staining, each slide was imaged using a 20× magnification on a Leica microscope (Wetzlar, Germany, DM3000) to take 20-40 fields of view per sample. The area of the myofibers was analyzed using Image J software (NIH, USA), with a minimum of 400 fibers per mouse being analyzed.
WGA lectin staining was performed as it is a fast, reliable and an inexpensive method used for skeletal muscle fiber, compared to other antibody-based techniques[38]. The frozen tissue sections were stained with WGA (1:200, Sigma, MO, USA), and photographed with Carl Zeiss fluorescence microscope (Oberkochen, Germany, Axio Imager M2) at 20× magnification, and the area of the myofibers was analyzed with Image J software with a minimum of 400 fibers per mouse being counted.
Statistical analysis
Data are represented as mean ± SD. An unpaired, two-tailed Student’s t test was used for comparisons between the two groups. Two-way ANOVA with Tukey test was performed to compare multiple groups. All analyses were performed using GraphPad Prism 8.0. Differences with p < 0.05, were considered significant.
